ID: 924826803_924826814

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 924826803 924826814
Species Human (GRCh38) Human (GRCh38)
Location 1:247548310-247548332 1:247548338-247548360
Sequence CCAGCTTGTGCTTTGTGGCTCTG CAGCCTAGGGGAGGAAGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 222} {0: 1, 1: 0, 2: 7, 3: 51, 4: 477}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!