ID: 924856541_924856545

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 924856541 924856545
Species Human (GRCh38) Human (GRCh38)
Location 1:247880058-247880080 1:247880107-247880129
Sequence CCCCAATGCTGGTTTGTATGTGG TGAATAAATGATTGACTATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 154} {0: 1, 1: 0, 2: 4, 3: 58, 4: 447}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!