ID: 924953393_924953399

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 924953393 924953399
Species Human (GRCh38) Human (GRCh38)
Location 1:248906166-248906188 1:248906181-248906203
Sequence CCGGGGCGTGGCCTGGCCCGGGG GCCCGGGGGCGTGGCATGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 58, 4: 457} {0: 1, 1: 1, 2: 1, 3: 31, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!