ID: 924955040_924955045

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 924955040 924955045
Species Human (GRCh38) Human (GRCh38)
Location 1:248917932-248917954 1:248917947-248917969
Sequence CCATCACTGGTGAAGCTGTATCA CTGTATCAGGAGAAGGTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 91} {0: 1, 1: 0, 2: 1, 3: 23, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!