ID: 925069382_925069389

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 925069382 925069389
Species Human (GRCh38) Human (GRCh38)
Location 2:954632-954654 2:954670-954692
Sequence CCTTCCTATTTCTGTATTAAATG TGGGTGTAATCCCTCACCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 348} {0: 1, 1: 0, 2: 1, 3: 12, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!