ID: 925070429_925070430

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 925070429 925070430
Species Human (GRCh38) Human (GRCh38)
Location 2:962537-962559 2:962551-962573
Sequence CCTCTGCAATGCAGAAAAATAAT AAAAATAATTAGATGAAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 39, 4: 421} {0: 1, 1: 1, 2: 5, 3: 93, 4: 901}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!