ID: 925084775_925084784

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 925084775 925084784
Species Human (GRCh38) Human (GRCh38)
Location 2:1099506-1099528 2:1099533-1099555
Sequence CCAGTATGCAGGTAGAGTGCCCT AGGCTGGAGGTCCCAGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 75} {0: 1, 1: 0, 2: 6, 3: 85, 4: 719}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!