ID: 925104423_925104428

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 925104423 925104428
Species Human (GRCh38) Human (GRCh38)
Location 2:1278366-1278388 2:1278389-1278411
Sequence CCATATCAGTTACTGCACCAGGT TGCTGTTTATGGAGGGCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 90} {0: 1, 1: 0, 2: 1, 3: 7, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!