ID: 925110707_925110710

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 925110707 925110710
Species Human (GRCh38) Human (GRCh38)
Location 2:1334007-1334029 2:1334054-1334076
Sequence CCCACGGAAAGGGATAAAATCTT ACTAATATCCAGACTCTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 747, 4: 14576} {0: 1, 1: 36, 2: 826, 3: 3572, 4: 4337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!