ID: 925139948_925139953

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 925139948 925139953
Species Human (GRCh38) Human (GRCh38)
Location 2:1543221-1543243 2:1543256-1543278
Sequence CCGTCCTCATTTCACATGTGAAG AGAGTGCTGGGTCCCAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 56, 4: 354} {0: 1, 1: 2, 2: 13, 3: 82, 4: 444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!