ID: 925179754_925179756

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 925179754 925179756
Species Human (GRCh38) Human (GRCh38)
Location 2:1809462-1809484 2:1809514-1809536
Sequence CCTTCATTGTATAACTTTCAGAG TTGCTTAAAAATCTTTATTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 175} {0: 1, 1: 1, 2: 3, 3: 55, 4: 607}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!