ID: 925182728_925182742

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 925182728 925182742
Species Human (GRCh38) Human (GRCh38)
Location 2:1827428-1827450 2:1827471-1827493
Sequence CCCCTGGCAATGTGGTCCTCATT AGGGGATCTCAGAGAGTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 147} {0: 1, 1: 0, 2: 1, 3: 16, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!