ID: 925214956_925214967

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 925214956 925214967
Species Human (GRCh38) Human (GRCh38)
Location 2:2086591-2086613 2:2086629-2086651
Sequence CCTCCATGCCTTATCACCCCCTT GCTTCTGCCTGCCCTGCTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 282} {0: 1, 1: 0, 2: 7, 3: 47, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!