ID: 925358103_925358104

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 925358103 925358104
Species Human (GRCh38) Human (GRCh38)
Location 2:3256843-3256865 2:3256857-3256879
Sequence CCGGACACGGGCGGGCTTGGGCA GCTTGGGCACGCAGCCCCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72} {0: 1, 1: 0, 2: 0, 3: 12, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!