ID: 925360665_925360676

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 925360665 925360676
Species Human (GRCh38) Human (GRCh38)
Location 2:3278233-3278255 2:3278277-3278299
Sequence CCACCTGCATCCCTGCATCCTGC CACCACATGCAGACTGTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 77, 4: 674} {0: 1, 1: 0, 2: 0, 3: 21, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!