ID: 925366283_925366288

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 925366283 925366288
Species Human (GRCh38) Human (GRCh38)
Location 2:3314267-3314289 2:3314295-3314317
Sequence CCGGCTGCCGCTAATGCCAGCTG CAGCCCCCTTTCCTGAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 126} {0: 1, 1: 0, 2: 3, 3: 34, 4: 370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!