ID: 925378268_925378272

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 925378268 925378272
Species Human (GRCh38) Human (GRCh38)
Location 2:3404515-3404537 2:3404544-3404566
Sequence CCTTAGTTACTTGGATTTTATCC CATTATATGCATGAACTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 197} {0: 1, 1: 0, 2: 2, 3: 5, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!