ID: 925396367_925396377

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 925396367 925396377
Species Human (GRCh38) Human (GRCh38)
Location 2:3536416-3536438 2:3536443-3536465
Sequence CCTCCGAGTCCCCTCGTGGACCA CTGACCTTGGGCTCTGTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61} {0: 2, 1: 6, 2: 16, 3: 43, 4: 385}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!