ID: 925451571_925451576

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 925451571 925451576
Species Human (GRCh38) Human (GRCh38)
Location 2:3973651-3973673 2:3973692-3973714
Sequence CCATTGTCTCTTTGTATATCCAG GGCTCCAGCCCTTCCTGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 57, 4: 401} {0: 1, 1: 0, 2: 3, 3: 53, 4: 389}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!