ID: 925988407_925988411

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 925988407 925988411
Species Human (GRCh38) Human (GRCh38)
Location 2:9234462-9234484 2:9234480-9234502
Sequence CCTTGCAGGGGCCTTGATAATAG AATAGGAGGAGCTCAGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113} {0: 1, 1: 0, 2: 1, 3: 18, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!