ID: 925997864_925997865

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 925997864 925997865
Species Human (GRCh38) Human (GRCh38)
Location 2:9306679-9306701 2:9306731-9306753
Sequence CCTGGCTCGCTGAGGGAATTGTC TGTTTGCATTCCTCCTTCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63} {0: 1, 1: 1, 2: 10, 3: 84, 4: 596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!