ID: 926077367_926077383

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 926077367 926077383
Species Human (GRCh38) Human (GRCh38)
Location 2:9951904-9951926 2:9951942-9951964
Sequence CCGCACCTGCAGCGAGCGAGCCG CCGCGCGGGCGGGCGGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73} {0: 1, 1: 1, 2: 21, 3: 122, 4: 791}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!