ID: 926092119_926092125

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 926092119 926092125
Species Human (GRCh38) Human (GRCh38)
Location 2:10057966-10057988 2:10057986-10058008
Sequence CCCCGCAGGCACTGGCCAGGCTG CTGCCTGTGAGAGGGAGAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 277} {0: 1, 1: 0, 2: 4, 3: 35, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!