ID: 926149284_926149297

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 926149284 926149297
Species Human (GRCh38) Human (GRCh38)
Location 2:10415704-10415726 2:10415752-10415774
Sequence CCTGTTATTCGGGGGGAGTCCAG CAAGGTCCCCCGAGCAGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33} {0: 1, 1: 0, 2: 0, 3: 22, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!