ID: 926196346_926196357

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 926196346 926196357
Species Human (GRCh38) Human (GRCh38)
Location 2:10765769-10765791 2:10765811-10765833
Sequence CCTTCCCTGCCTCACCATGTGCC CCCAGGGATGCCAGACTCAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 87, 4: 619} {0: 1, 1: 0, 2: 2, 3: 29, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!