ID: 926303327_926303340

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 926303327 926303340
Species Human (GRCh38) Human (GRCh38)
Location 2:11619032-11619054 2:11619059-11619081
Sequence CCGTGGTGGAATCTTCTCCAATG GGGGTGGACCGGAGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 167} {0: 1, 1: 0, 2: 4, 3: 107, 4: 1723}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!