ID: 926315166_926315176

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 926315166 926315176
Species Human (GRCh38) Human (GRCh38)
Location 2:11704391-11704413 2:11704442-11704464
Sequence CCCGGGGGAGGCAGAGCGGGGTA TCCAGTGGGATATGAGGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 296} {0: 1, 1: 0, 2: 0, 3: 10, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!