ID: 926369830_926369839

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 926369830 926369839
Species Human (GRCh38) Human (GRCh38)
Location 2:12168614-12168636 2:12168663-12168685
Sequence CCACTTCACGTGGTCTCTGGGAA CAGGGGGCCCAGAGAGAAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 81, 4: 598}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!