ID: 926551513_926551515

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 926551513 926551515
Species Human (GRCh38) Human (GRCh38)
Location 2:14307055-14307077 2:14307083-14307105
Sequence CCTTGTGAATTCAGATGGGTTCC CAGACCCACATGATGTTTTAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!