ID: 926580946_926580958

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 926580946 926580958
Species Human (GRCh38) Human (GRCh38)
Location 2:14632726-14632748 2:14632765-14632787
Sequence CCGAGCCGGGACTGTCCAGTGGG AGCGCAGACCTGGAGGCGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 124} {0: 1, 1: 0, 2: 0, 3: 14, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!