ID: 926593106_926593118

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 926593106 926593118
Species Human (GRCh38) Human (GRCh38)
Location 2:14760371-14760393 2:14760417-14760439
Sequence CCGGGAGCCTGAGGCGACCCCAG CCAGACAGCAGTGCCCAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 395} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!