ID: 926657588_926657592

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 926657588 926657592
Species Human (GRCh38) Human (GRCh38)
Location 2:15425722-15425744 2:15425746-15425768
Sequence CCTCCTGGCATCTCTTACATCTG TCTATTTTTGCAAGAAAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 209} {0: 1, 1: 0, 2: 2, 3: 55, 4: 578}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!