ID: 926725850_926725862

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 926725850 926725862
Species Human (GRCh38) Human (GRCh38)
Location 2:15997305-15997327 2:15997358-15997380
Sequence CCTTCCTGATGCTGGTGGCCCTG GATCTCTGAAGGCACTGACTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 36, 4: 360} {0: 1, 1: 0, 2: 0, 3: 21, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!