ID: 926799125_926799128

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 926799125 926799128
Species Human (GRCh38) Human (GRCh38)
Location 2:16643648-16643670 2:16643668-16643690
Sequence CCCAGTTCTATCTGTATTCGCCC CCCACAATCAGACACTCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 59} {0: 1, 1: 0, 2: 3, 3: 15, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!