ID: 926887645_926887649

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 926887645 926887649
Species Human (GRCh38) Human (GRCh38)
Location 2:17612726-17612748 2:17612741-17612763
Sequence CCAGGTTGCCTCTGGGCTTTAAC GCTTTAACATGTTGCTGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 145} {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!