ID: 927152157_927152159

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 927152157 927152159
Species Human (GRCh38) Human (GRCh38)
Location 2:20202463-20202485 2:20202485-20202507
Sequence CCTGGGGAGAGGCTGCTTCAGTT TTGGAGAAACCGAGTCAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 236} {0: 1, 1: 0, 2: 0, 3: 22, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!