ID: 927162604_927162607

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 927162604 927162607
Species Human (GRCh38) Human (GRCh38)
Location 2:20282089-20282111 2:20282108-20282130
Sequence CCTCATGAAGTAAAAGCTGCCAG CCAGCTGCACCGATAGAACTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 177} {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!