ID: 927186278_927186289

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 927186278 927186289
Species Human (GRCh38) Human (GRCh38)
Location 2:20484821-20484843 2:20484862-20484884
Sequence CCCTAACCCAAAATGTGATGGTA GGGAGCTGATTTCACTTAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 3, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!