ID: 927198345_927198352

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 927198345 927198352
Species Human (GRCh38) Human (GRCh38)
Location 2:20563416-20563438 2:20563437-20563459
Sequence CCCCAGCAATGAGGGCCCAGCCT CTGGCCCCTGCAATGAGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 211} {0: 1, 1: 0, 2: 2, 3: 25, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!