ID: 927199930_927199936

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 927199930 927199936
Species Human (GRCh38) Human (GRCh38)
Location 2:20571819-20571841 2:20571832-20571854
Sequence CCTGGTATCTCCCCAGTGCCACT CAGTGCCACTGCCAAAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 180} {0: 1, 1: 0, 2: 0, 3: 15, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!