ID: 927206628_927206635

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 927206628 927206635
Species Human (GRCh38) Human (GRCh38)
Location 2:20615279-20615301 2:20615304-20615326
Sequence CCGTTTGTGCCCACAGAACCTGG GCTGCTTCACAGGATGCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 230} {0: 1, 1: 0, 2: 4, 3: 23, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!