ID: 927472354_927472371

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 927472354 927472371
Species Human (GRCh38) Human (GRCh38)
Location 2:23385712-23385734 2:23385743-23385765
Sequence CCCTCCTGCGCCCACCCGCGACC TCTGCGCGTCGGGCCGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 238} {0: 1, 1: 0, 2: 2, 3: 13, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!