ID: 927472355_927472370

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 927472355 927472370
Species Human (GRCh38) Human (GRCh38)
Location 2:23385713-23385735 2:23385739-23385761
Sequence CCTCCTGCGCCCACCCGCGACCC GCTCTCTGCGCGTCGGGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 53, 4: 471} {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!