ID: 927472361_927472373

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 927472361 927472373
Species Human (GRCh38) Human (GRCh38)
Location 2:23385726-23385748 2:23385756-23385778
Sequence CCCGCGACCCCGGGCTCTCTGCG CCGGGGCCGGAGCCGCGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 191} {0: 1, 1: 0, 2: 3, 3: 71, 4: 559}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!