ID: 927491706_927491722

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 927491706 927491722
Species Human (GRCh38) Human (GRCh38)
Location 2:23525512-23525534 2:23525562-23525584
Sequence CCTCTCTCTCCTGCGTGACCAGC GCAGTGGGATGGAGCTAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 233} {0: 1, 1: 0, 2: 3, 3: 16, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!