ID: 927519433_927519448

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 927519433 927519448
Species Human (GRCh38) Human (GRCh38)
Location 2:23690092-23690114 2:23690132-23690154
Sequence CCGCAGCAGGATTGCACCTCCCC CCTGTGCTGAGGCCCTGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 194} {0: 1, 1: 0, 2: 8, 3: 81, 4: 606}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!