ID: 927605380_927605386

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 927605380 927605386
Species Human (GRCh38) Human (GRCh38)
Location 2:24482264-24482286 2:24482285-24482307
Sequence CCACTGCACCCCCAACACTTAGA GAATAATGCTTGGCCCATACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!