ID: 927615178_927615180

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 927615178 927615180
Species Human (GRCh38) Human (GRCh38)
Location 2:24586747-24586769 2:24586777-24586799
Sequence CCTGGCCAGCTTGCTATACTTCT TTTTCTACACATATGCAACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 234} {0: 1, 1: 0, 2: 2, 3: 19, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!