ID: 927646076_927646083

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 927646076 927646083
Species Human (GRCh38) Human (GRCh38)
Location 2:24877775-24877797 2:24877796-24877818
Sequence CCATCTGACCACCAGACAGAGAG AGGGAAGAGGCTCCTTGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 270} {0: 1, 1: 0, 2: 1, 3: 29, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!