ID: 927655903_927655912

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 927655903 927655912
Species Human (GRCh38) Human (GRCh38)
Location 2:24946306-24946328 2:24946345-24946367
Sequence CCCAAAGGATCCACACTTGCCTC GGCCAAGGCTTAGAAGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126} {0: 1, 1: 0, 2: 3, 3: 28, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!